PCR products were visualized after 10% PAGE with ethidium bromide. diluted 250-fold and reamplified for 40 cycles (94C, 30 s; 60C, 30 s; 72C, 1 min) using internal primer pairs. PCR products were visualized after 10% PAGE with ethidium bromide. Sequences of nested primer pairs for -actin, KCC2, and NKCC1 were given previously (Yamada et al., 2004). Outside and inside primer pairs for ClC2 were 5-CATGGAATCAGCAGGCATTG-3/5-GGCACTTGTCATCACTATCA-3 and 5-GTGACAAACGCAAGCTGAAG-3/5-GTGACAATCCCAATGAGTCT-3, respectively (GenBank accession number “type”:”entrez-nucleotide”,”attrs”:”text”:”AF005720″,”term_id”:”2873366″,”term_text”:”AF005720″AF005720). hybridization protocols and antisense mRNA probes for NKCC1 are described in detail previously (Kanaka et al., 2001). The sequence of reelin antisense probe was CACGACAACATGGGCTCAGGCACTTCTACAAC (GenBank accession number “type”:”entrez-nucleotide”,”attrs”:”text”:”AB049473″,”term_id”:”17221617″,”term_text”:”AB049473″AB049473) (Kikkawa et al., 2003). Detection of hybridization probes was performed using emulsion microautoradiography on thionin-stained sections to allow morphological CD5 identification. Immunohistochemistry. Tangential brain slices were fixed for 18C24 h Tyk2-IN-7 immediately after preparation. After washing in phosphate buffer (PB), slices were incubated in blocking solution (4% normal goat and 3% normal bovine serum, 0.5% Triton X-100, 0.05% azide in PBS) for 2 h at room temperature. Primary antibodies were incubated overnight at room temperature. For NKCC1 staining, the T4 antibody (1:800; Developmental Hybridoma Bank, Iowa City, IA) (Lytle et al., 1995) was used, and Tyk2-IN-7 for reelin detection, the antibody SP142 (1:400; Chemicon, Hampshire, UK) (De Bergeyck et al., 1998) was used. After rinsing, the slices were incubated with secondary antibody [Alexa 568 coupled anti-mouse IG (Invitrogen, Karlsruhe, Germany), 1:400 for NKCC1 and Cy-2-conjugated anti-mouse antigen-binding fragments (FAB) (Dianova, Hamburg, Germany), 1:100 for reelin] for 2 h at space temperature. For simultaneous staining of NKCC1 and reelin immunoreactivity, slices were 1st exposed to SP142 antibody over night. After rinsing, antibodies were marked with the Cy-2-conjugated anti-mouse FAB fragments. After rinsing, the slices were incubated for 48 h at 4C with T4 antibody, which was consequently designated with the secondary antibody. In whole-cell recordings, 0.5% biocytin was added to the pipette solutions. These slices were fixed over night and, after washing biocytin-labeled cells, were stained with streptavidin-conjugated with Cy-3 (Dianova) or Alexa 488 (Invitrogen). Some of these slices were consequently counterstained for reelin according to the protocol explained above. The slices were inlayed in fluoromount (Sigma, Taufkirchen, Germany). Immunofluorescence was investigated having a Nipkow spinning Tyk2-IN-7 disk confocal system (Visitech, Sunderland, UK) attached to a conventional fluorescence microscope (Olympus BX51 WI; Olympus Optical, Tokyo, Japan) equipped with water immersion objectives and a cooled CCD video camera (CoolSnap HQ; Roper Scientific, Ottobrunn, Germany) controlled by MetaMorph software (Common Imaging, Western Chester, PA). Green and reddish fluorescence was excited with the 488 and 568 nm lines of a Kr/Ar laser (Laser Physics, Malpas, UK). Solutions and drugs. ACSF utilized for slice preparation, and electrophysiological recordings consisted of the following (in mm): 126 NaCl, 26 NaHCO3, 1.25 NaH2PO5, 1 MgCl2, 2 CaCl2, 2.5 KCl, and 20 glucose and was equilibrated with 95% O2/5% CO2 (pH 7.4; osmolarity, 336 mOsm). Na+-free ACSF contained the following (in mm): 127.5 Tris-HCl, 1.25 KH2PO5, 1 MgCl2, 2 CaCl2, 1.25 KCl, 20 glucose, and 26 choline-HCO3. The following stock solutions were used: 50 mm bumetanide, 125 mm disodium 4,4-diisothiocyanatostilbene-2,2-disulfonate (DIDS), 1 mm 9-anthracenecarboxylic acid (9-AC), 30 mm strychnine and 10 mm gabazine (GBZ) in DMSO as well as 1 mm tetrodotoxin (TTX) in citrate buffer. The final DMSO concentration by no means exceeded 0.3%. All substances except TTX (Tocris Cookson, Ballwin, MO) were from Sigma. Statistics. All ideals are indicated as mean SEM. For statistical analysis of self-employed data units, the KolmogorovCSmirnov test was used, and for combined data units, the sign-test was used (Systat 11; Systat, Point Richmond, CA). Results were designated significant at a level of 0.05, and significance levels are indicated by * 0.05,.